Sequence retrieval

Genome: Vibrio sp. EJY3
Start position: 2067478
End position: 2067501
Length: 24

DNA sequence
>NC_016613, from 2067478 to 2067501 (24 bp); Vibrio sp. EJY3 TTAAGTAATTGAGTAATTAAGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2066233-2067486	Sequence	VEJY3_09270 - sugar ABC transporter periplasmic substrate-binding protein