Sequence retrieval

Genome: Vibrio sp. EJY3
Start position: 1485265
End position: 1485312
Length: 48

DNA sequence
>NC_016613, from 1485265 to 1485312 (48 bp); Vibrio sp. EJY3 ACTAGAACTAGAACTAGAACTAGAACTAGAACTAGAACTAGAACTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1483436-1486195	Sequence	VEJY3_06635 - hypothetical protein (Protein is coded in complementary strand; from 1486195 to 1483436)