Sequence retrieval

Genome: Geobacillus thermoleovorans CCB_US3_UF5
Start position: 415123
End position: 415158
Length: 36

DNA sequence
>NC_016593, from 415123 to 415158 (36 bp); Geobacillus thermoleovorans CCB_US3_UF5 TTGCTTTTTCCATTCCTTTCTCCATTCCTTTCTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 415020-415886	Sequence	GTCCBUS3UF5_4320 - hypothetical protein (Protein is coded in complementary strand; from 415886 to 415020)