Sequence retrieval

Genome: Geobacillus thermoleovorans CCB_US3_UF5
Start position: 3495338
End position: 3495364
Length: 27

DNA sequence
>NC_016593, from 3495338 to 3495364 (27 bp); Geobacillus thermoleovorans CCB_US3_UF5 ACTCATCGTATTCATCGTATTCATCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3495124-3495447	Sequence	GTCCBUS3UF5_38060 - DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 3495447 to 3495124)