Sequence retrieval

Genome: Geobacillus thermoleovorans CCB_US3_UF5
Start position: 3322483
End position: 3322518
Length: 36

DNA sequence
>NC_016593, from 3322483 to 3322518 (36 bp); Geobacillus thermoleovorans CCB_US3_UF5 CCTTTTTCGATTCCTTTTTCGATTCCTTTTTCGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3322378-3323256	Sequence	GTCCBUS3UF5_36120 - transposase (Protein is coded in complementary strand; from 3323256 to 3322378)