Sequence retrieval

Genome: Geobacillus thermoleovorans CCB_US3_UF5
Start position: 2323290
End position: 2323313
Length: 24

DNA sequence
>NC_016593, from 2323290 to 2323313 (24 bp); Geobacillus thermoleovorans CCB_US3_UF5 AAAAAAGGAAAAAACGAAAAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2323237-2323629	Sequence	GTCCBUS3UF5_25260 - hypothetical protein (Protein is coded in complementary strand; from 2323629 to 2323237)