Sequence retrieval

Genome: Geobacillus thermoleovorans CCB_US3_UF5
Start position: 2080930
End position: 2080959
Length: 30

DNA sequence
>NC_016593, from 2080930 to 2080959 (30 bp); Geobacillus thermoleovorans CCB_US3_UF5 ATTTTTGTAGATTTCCGTAGATTTTCGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2080868-2080990	Sequence	GTCCBUS3UF5_22570 - hypothetical protein (Protein is coded in complementary strand; from 2080990 to 2080868)