Sequence retrieval

Genome: Geobacillus thermoleovorans CCB_US3_UF5
Start position: 2064016
End position: 2064063
Length: 48

DNA sequence
>NC_016593, from 2064016 to 2064063 (48 bp); Geobacillus thermoleovorans CCB_US3_UF5 GTTGTTTCATTCCTTGCTTCATTCCTTGCTTCATTCCTTGTTTCATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2063910-2064839	Sequence	GTCCBUS3UF5_22420 - hypothetical protein (Protein is coded in complementary strand; from 2064839 to 2063910)