Sequence retrieval

Genome: Geobacillus thermoleovorans CCB_US3_UF5
Start position: 1928078
End position: 1928101
Length: 24

DNA sequence
>NC_016593, from 1928078 to 1928101 (24 bp); Geobacillus thermoleovorans CCB_US3_UF5 ATGATGGTGATGATGATGGTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1928076-1928903	Sequence	GTCCBUS3UF5_21000 - Cobalamin (Vitamin B12) biosynthesis CbiX protein (Protein is coded in complementary strand; from 1928903 to 1928076)