Sequence retrieval

Genome: Geobacillus thermoleovorans CCB_US3_UF5
Start position: 1217254
End position: 1217283
Length: 30

DNA sequence
>NC_016593, from 1217254 to 1217283 (30 bp); Geobacillus thermoleovorans CCB_US3_UF5 TATGATAAAATAGGAAAAAAAGTGATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1217153-1217326	Sequence	GTCCBUS3UF5_13160 - hypothetical protein (Protein is coded in complementary strand; from 1217326 to 1217153)