Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 890957
End position: 890980
Length: 24

DNA sequence
>NC_016510, from 890957 to 890980 (24 bp); Flavobacterium columnare ATCC 49512 CTACTTCTGCTTCTATTTCTACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 890824-891273	Sequence	FCOL_03810 - hypothetical protein (Protein is coded in complementary strand; from 891273 to 890824)