Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 77813
End position: 77836
Length: 24

DNA sequence
>NC_016510, from 77813 to 77836 (24 bp); Flavobacterium columnare ATCC 49512 TCTTCTTCGTCTTTTTCTTCGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 77750-78124	Sequence	FCOL_00345 - hypothetical protein (Protein is coded in complementary strand; from 78124 to 77750)