Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 645955
End position: 645984
Length: 30

DNA sequence
>NC_016510, from 645955 to 645984 (30 bp); Flavobacterium columnare ATCC 49512 TTTATTTATTATTATTTCTTTTTTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 645957-646256	Sequence	FCOL_02820 - hypothetical protein (Protein is coded in complementary strand; from 646256 to 645957)