Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 620455
End position: 620478
Length: 24

DNA sequence
>NC_016510, from 620455 to 620478 (24 bp); Flavobacterium columnare ATCC 49512 ATCTTCATCCTCATATTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 618719-621220	Sequence	FCOL_02670 - DNA translocase FtsK (Protein is coded in complementary strand; from 621220 to 618719)