Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 561748
End position: 561772
Length: 25

DNA sequence
>NC_016510, from 561748 to 561772 (25 bp); Flavobacterium columnare ATCC 49512 TTTTTTTTGTTTTTCTTCTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 561197-562450	Sequence	FCOL_02420 - precorrin-6y C5,15-methyltransferase subunit CbiE (Protein is coded in complementary strand; from 562450 to 561197)