Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2979955
End position: 2979979
Length: 25

DNA sequence
>NC_016510, from 2979955 to 2979979 (25 bp); Flavobacterium columnare ATCC 49512 TTTGTTTTCTTATGTCTTGTTCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2979270-2980217	Sequence	FCOL_12715 - hypothetical protein (Protein is coded in complementary strand; from 2980217 to 2979270)