Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2868998
End position: 2869021
Length: 24

DNA sequence
>NC_016510, from 2868998 to 2869021 (24 bp); Flavobacterium columnare ATCC 49512 AGAAGAAGAAGCAGAAAAAAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2867602-2870964	Sequence	FCOL_12165 secA preprotein translocase subunit SecA