Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 278103
End position: 278126
Length: 24

DNA sequence
>NC_016510, from 278103 to 278126 (24 bp); Flavobacterium columnare ATCC 49512 CAAGAAAAAAAGAAAACAATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 277728-278168	Sequence	FCOL_01140 - hypothetical protein (Protein is coded in complementary strand; from 278168 to 277728)