Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2695198
End position: 2695221
Length: 24

DNA sequence
>NC_016510, from 2695198 to 2695221 (24 bp); Flavobacterium columnare ATCC 49512 TCTTCTTCTACTTCTTCCTCCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2691106-2696796	Sequence	FCOL_11385 - lipoprotein precursor (Protein is coded in complementary strand; from 2696796 to 2691106)