Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2605233
End position: 2605262
Length: 30

DNA sequence
>NC_016510, from 2605233 to 2605262 (30 bp); Flavobacterium columnare ATCC 49512 TCTTCTTTCTTCCACTTTCTCCTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2604227-2605573	Sequence	FCOL_10980 secY preprotein translocase subunit SecY (Protein is coded in complementary strand; from 2605573 to 2604227)