Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2603546
End position: 2603569
Length: 24

DNA sequence
>NC_016510, from 2603546 to 2603569 (24 bp); Flavobacterium columnare ATCC 49512 TTTTTCTTTTACCTTTTCTTGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2603515-2603889	Sequence	FCOL_10965 rpsM 30S ribosomal protein S13 (Protein is coded in complementary strand; from 2603889 to 2603515)