Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2599652
End position: 2599676
Length: 25

DNA sequence
>NC_016510, from 2599652 to 2599676 (25 bp); Flavobacterium columnare ATCC 49512 TTATTTAATTTTATATTCTTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2599653-2600765	Sequence	FCOL_10940 - carbamoyl phosphate synthase small subunit (Protein is coded in complementary strand; from 2600765 to 2599653)