Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 252097
End position: 252120
Length: 24

DNA sequence
>NC_016510, from 252097 to 252120 (24 bp); Flavobacterium columnare ATCC 49512 TCTTCACTTCTTCACTTCTTCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 252117-252755	Sequence	FCOL_01030 - phosphoribosylanthranilate isomerase (Protein is coded in complementary strand; from 252755 to 252117)