Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2493072
End position: 2493096
Length: 25

DNA sequence
>NC_016510, from 2493072 to 2493096 (25 bp); Flavobacterium columnare ATCC 49512 TTTTTTATTTTTTTCTTTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2491548-2493116	Sequence	FCOL_10535 - hypothetical protein (Protein is coded in complementary strand; from 2493116 to 2491548)