Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2482720
End position: 2482749
Length: 30

DNA sequence
>NC_016510, from 2482720 to 2482749 (30 bp); Flavobacterium columnare ATCC 49512 TCTAAACTAATATAATCTGATTTAATCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2482498-2485650	Sequence	FCOL_10500 - TonB-dependent receptor plug (Protein is coded in complementary strand; from 2485650 to 2482498)