Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2460894
End position: 2460917
Length: 24

DNA sequence
>NC_016510, from 2460894 to 2460917 (24 bp); Flavobacterium columnare ATCC 49512 TATTTTTATCTTTATTTCTATTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2456621-2460988	Sequence	FCOL_10400 - DNA-directed RNA polymerase subunit beta' (Protein is coded in complementary strand; from 2460988 to 2456621)