Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2450630
End position: 2450659
Length: 30

DNA sequence
>NC_016510, from 2450630 to 2450659 (30 bp); Flavobacterium columnare ATCC 49512 AAAAAAAATAAAAAATAAAAAAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2448845-2450683	Sequence	FCOL_10370 - hypothetical protein (Protein is coded in complementary strand; from 2450683 to 2448845)