Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2003124
End position: 2003147
Length: 24

DNA sequence
>NC_016510, from 2003124 to 2003147 (24 bp); Flavobacterium columnare ATCC 49512 AGAACCATAACCAGCACCAGATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2002435-2003745	Sequence	FCOL_08640 - argininosuccinate lyase (Protein is coded in complementary strand; from 2003745 to 2002435)