Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1968899
End position: 1968923
Length: 25

DNA sequence
>NC_016510, from 1968899 to 1968923 (25 bp); Flavobacterium columnare ATCC 49512 TTTTTTTTATTTTTATTTTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1968620-1970017	Sequence	FCOL_08480 - hypothetical protein (Protein is coded in complementary strand; from 1970017 to 1968620)