Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1706258
End position: 1706287
Length: 30

DNA sequence
>NC_016510, from 1706258 to 1706287 (30 bp); Flavobacterium columnare ATCC 49512 ATTTTTTTTTGTTTTTTTTTATCTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1706287-1707765	Sequence	FCOL_07355 - prolyl-tRNA synthetase (Protein is coded in complementary strand; from 1707765 to 1706287)