Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1508225
End position: 1508248
Length: 24

DNA sequence
>NC_016510, from 1508225 to 1508248 (24 bp); Flavobacterium columnare ATCC 49512 TAATATTAATAGAAATATTAATAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1507743-1508378	Sequence	FCOL_06515 - cytochrome c oxidase, cbb3-type subunit III (Protein is coded in complementary strand; from 1508378 to 1507743)