Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1452690
End position: 1452716
Length: 27

DNA sequence
>NC_016510, from 1452690 to 1452716 (27 bp); Flavobacterium columnare ATCC 49512 TTTTCTATTTTTTCCATTTTTGCTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1451526-1453718	Sequence	FCOL_06265 - PAS/PAC sensor hybrid histidine kinase (Protein is coded in complementary strand; from 1453718 to 1451526)