Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1319356
End position: 1319382
Length: 27

DNA sequence
>NC_016510, from 1319356 to 1319382 (27 bp); Flavobacterium columnare ATCC 49512 AAAAACCTAAAACACCTAAAGAACCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1319241-1319858	Sequence	FCOL_05690 - hypothetical protein (Protein is coded in complementary strand; from 1319858 to 1319241)