Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1309082
End position: 1309105
Length: 24

DNA sequence
>NC_016510, from 1309082 to 1309105 (24 bp); Flavobacterium columnare ATCC 49512 TGTTTGATTGTTTGAATGTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1307117-1309489	Sequence	FCOL_05640 - TonB-dependent receptor (Protein is coded in complementary strand; from 1309489 to 1307117)