Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1292041
End position: 1292076
Length: 36

DNA sequence
>NC_016510, from 1292041 to 1292076 (36 bp); Flavobacterium columnare ATCC 49512 TTCAATCTTTCCTTCAATCTTTCCTTCAATCTTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1291952-1292848	Sequence	FCOL_05600 - hypothetical protein (Protein is coded in complementary strand; from 1292848 to 1291952)