Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1275669
End position: 1275716
Length: 48

DNA sequence
>NC_016510, from 1275669 to 1275716 (48 bp); Flavobacterium columnare ATCC 49512 TTCAATCTTTCCTTCAATCTTTCCTTCAATCTTTCCTTCAATCTTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1275580-1276464	Sequence	FCOL_05505 - hypothetical protein (Protein is coded in complementary strand; from 1276464 to 1275580)