Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 1026533
End position: 1026577
Length: 45

DNA sequence
>NC_016510, from 1026533 to 1026577 (45 bp); Flavobacterium columnare ATCC 49512 ATTATTTGAATTTTCTGAATTTGAATTTTCTGAATTTGAATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1025748-1026632	Sequence	FCOL_04355 - hypothetical protein (Protein is coded in complementary strand; from 1026632 to 1025748)