Sequence retrieval

Genome: Flavobacterium columnare ATCC 49512
Start position: 2941875
End position: 2941898
Length: 24

DNA sequence
>NC_016510, from 2941875 to 2941898 (24 bp); Flavobacterium columnare ATCC 49512 GGATACGGATACGGATACGGATAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2939593-2941962	Sequence	FCOL_12535 - tyrosine-protein kinase involved in exopolysaccharide biosynthesis