Sequence retrieval

Genome: Rickettsia japonica YH
Start position: 1236909
End position: 1236932
Length: 24

DNA sequence
>NC_016050, from 1236909 to 1236932 (24 bp); Rickettsia japonica YH TTATAGAATTTTAGAATTATAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1236879-1238126	Sequence	RJP_0971 proP1 proline/betaine transporter (Protein is coded in complementary strand; from 1238126 to 1236879)