Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 3872007
End position: 3872051
Length: 45

DNA sequence
>NC_016048, from 3872007 to 3872051 (45 bp); Oscillibacter valericigenes Sjm18-20 ACACGCTCGTTCATACCACGCTCGTTCATACCACGCTCTTCCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3869661-3872036	Sequence	OBV_40980 - pyruvate formate-lyase family protein (Protein is coded in complementary strand; from 3872036 to 3869661)