Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 2481230
End position: 2481265
Length: 36

DNA sequence
>NC_016048, from 2481230 to 2481265 (36 bp); Oscillibacter valericigenes Sjm18-20 CGCTTTTCCGGTCGGTTTTACGGTCTGTTTTCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2479080-2482805	Sequence	OBV_26270 - hypothetical protein (Protein is coded in complementary strand; from 2482805 to 2479080)