Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 2038736
End position: 2038771
Length: 36

DNA sequence
>NC_016048, from 2038736 to 2038771 (36 bp); Oscillibacter valericigenes Sjm18-20 CCATTTCCGCAGCCATTTCCGCAGCCGTTTCCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2038709-2038891	Sequence	OBV_21430 - hypothetical protein (Protein is coded in complementary strand; from 2038891 to 2038709)