Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 1710428
End position: 1710463
Length: 36

DNA sequence
>NC_016048, from 1710428 to 1710463 (36 bp); Oscillibacter valericigenes Sjm18-20 GGCCTTGGGGTAGGCTTGGGGGTAGGCTTGGGGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1709828-1711315	Sequence	OBV_17830 - hypothetical protein (Protein is coded in complementary strand; from 1711315 to 1709828)