Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 3152082
End position: 3152114
Length: 33

DNA sequence
>NC_016048, from 3152082 to 3152114 (33 bp); Oscillibacter valericigenes Sjm18-20 CAATATATTTATAATATATTGACAATATTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3152112-3152270	Sequence	OBV_33560 - hypothetical protein (Protein is coded in complementary strand; from 3152270 to 3152112)