Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 2327627
End position: 2327659
Length: 33

DNA sequence
>NC_016048, from 2327627 to 2327659 (33 bp); Oscillibacter valericigenes Sjm18-20 TCACAATGCCGTCACGATACCGTCACGACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2327639-2328763	Sequence	OBV_24510 - hypothetical protein (Protein is coded in complementary strand; from 2328763 to 2327639)