Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 2910776
End position: 2910805
Length: 30

DNA sequence
>NC_016048, from 2910776 to 2910805 (30 bp); Oscillibacter valericigenes Sjm18-20 CACAGCGGCGCACAGGGGCCGACAGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2910671-2911216	Sequence	OBV_30670 - hypothetical protein (Protein is coded in complementary strand; from 2911216 to 2910671)