Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 1922693
End position: 1922722
Length: 30

DNA sequence
>NC_016048, from 1922693 to 1922722 (30 bp); Oscillibacter valericigenes Sjm18-20 CCTGAATTTTCCTGTATTTATCTAAATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1922644-1922796	Sequence	OBV_20320 - hypothetical protein (Protein is coded in complementary strand; from 1922796 to 1922644)