Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 3166595
End position: 3166621
Length: 27

DNA sequence
>NC_016048, from 3166595 to 3166621 (27 bp); Oscillibacter valericigenes Sjm18-20 TAATCAGGGTAATCAAGGTAATCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3166543-3166803	Sequence	OBV_33690 - hypothetical protein (Protein is coded in complementary strand; from 3166803 to 3166543)