Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 166763
End position: 166789
Length: 27

DNA sequence
>NC_016048, from 166763 to 166789 (27 bp); Oscillibacter valericigenes Sjm18-20 GGTTTTTCGGGTTTTACGGGTTGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 166061-167017	Sequence	OBV_01710 - hypothetical protein (Protein is coded in complementary strand; from 167017 to 166061)