Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 4404328
End position: 4404351
Length: 24

DNA sequence
>NC_016048, from 4404328 to 4404351 (24 bp); Oscillibacter valericigenes Sjm18-20 AGCGCCAGCCCCAGCGCCAGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4402903-4404840	Sequence	OBV_46500 - putative esterase (Protein is coded in complementary strand; from 4404840 to 4402903)